circad | circRNAs associated with diseases

Hsa_circ_0079530
Gene	TWIST1	Organism	Human
Genome Locus	chr7:19155090-19155754:-	Build	hg19
Disease	Non small cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	29689350
Experimental Method
Sample Type	NSCLC cell lines and tissues	Comparison	samples of NSCLC and paired adjacent non-tumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAATAGATCCGGTGTCTAAATGC Reverse TCCATTTTCTCCTTCTCTGGAA	Statistics	Fold Change : Upregulated pvalue : p=0.014
Citation
Li, J, Wang, J, Chen, Z, Chen, Y, Jin, M (2018). Hsa_circ_0079530 promotes cell proliferation and invasion in non-small cell lung cancer. Gene, 665:1-5.